|
GenScript corporation
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pm38307859-283-32-48?v=GenScript+corporation Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
lentivirus coding scramble guide rna sequence ![]() Lentivirus Coding Scramble Guide Rna Sequence, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pmc11758933-40-2-13?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
lentivirus coding scramble guide rna sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
sgrna (small-guide rna) to knocking-out bmal2 as well as non-targeting (nt) sequence ![]() Sgrna (Small Guide Rna) To Knocking Out Bmal2 As Well As Non Targeting (Nt) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pmc10055246-164-1-16?v=GenScript+corporation Average 90 stars, based on 1 article reviews
sgrna (small-guide rna) to knocking-out bmal2 as well as non-targeting (nt) sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
guide rna (grna) sequences targeting the exon regions of the human il15ra gene ![]() Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pmc11986442-68-6-17?v=Broad+Institute+Inc Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
guide rna targeting sequence: sgvdr ![]() Guide Rna Targeting Sequence: Sgvdr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pm37478851-251-9-10?v=GenScript+corporation Average 90 stars, based on 1 article reviews
guide rna targeting sequence: sgvdr - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
single-guide rna target sequence ![]() Single Guide Rna Target Sequence, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pm33558728-240-1-10?v=ToolGen+Incorporated Average 90 stars, based on 1 article reviews
single-guide rna target sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ATUM Bio
oligo sequences for guide rna targeting lamp2a, prdx1 and crtc1 ![]() Oligo Sequences For Guide Rna Targeting Lamp2a, Prdx1 And Crtc1, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pmc06413476-110-11-15?v=ATUM+Bio Average 90 stars, based on 1 article reviews
oligo sequences for guide rna targeting lamp2a, prdx1 and crtc1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
mouse non-targeting grna (guide rna) sequence ![]() Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pm33197448-108-8-28?v=GenScript+corporation Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
single guide rna (sgrna) including the sequence targeting the neu2 gene ![]() Single Guide Rna (Sgrna) Including The Sequence Targeting The Neu2 Gene, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pmc08881595-32-7-20?v=ToolGen+Incorporated Average 90 stars, based on 1 article reviews
single guide rna (sgrna) including the sequence targeting the neu2 gene - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
LGC Biosearch
custom stellaris rna-fish probes targeting either the coding sequences (cds core rd-histone) ![]() Custom Stellaris Rna Fish Probes Targeting Either The Coding Sequences (Cds Core Rd Histone), supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/bio_rxiv__2024__12__16__628706-265-9-62?v=LGC+Biosearch Average 90 stars, based on 1 article reviews
custom stellaris rna-fish probes targeting either the coding sequences (cds core rd-histone) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
small interfering rna targeting kat6a ![]() Small Interfering Rna Targeting Kat6a, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pmc13113684-105-0-9?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
small interfering rna targeting kat6a - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
GenScript corporation
gcc88 crispr guide rna (grna) plasmid (grna targeting sequence: caactggcctcttcggactt) ![]() Gcc88 Crispr Guide Rna (Grna) Plasmid (Grna Targeting Sequence: Caactggcctcttcggactt), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/coding+sequence+targeting+guide+rna/pm30791178-23-1-14?v=GenScript+corporation Average 90 stars, based on 1 article reviews
gcc88 crispr guide rna (grna) plasmid (grna targeting sequence: caactggcctcttcggactt) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Investigative Ophthalmology & Visual Science
Article Title: Mechanical Strain of Corneal Epithelium Influences the Expression of Genes Implicated in Keratoconus
doi: 10.1167/iovs.66.1.52
Figure Lengend Snippet: WNT10A regulates collagen XII production and TGFB1 pathway in corneal epithelial cells. Cas9-expressing hTCepi cells were transduced with a lentivirus coding for two individual WNT10A guide RNA sequences and compared to Cas9 cells transduced with a nontargeting sequence. Cell lysates were analyzed for transcript and protein levels of WNT10A, collagen XII, and collagen I (panels A and B , respectively). Transcript levels for MMP9 as a marker of keratoconus, and AXIN2 as a marker of Wnt pathway activation were also measured (panel A ). In order to evaluate the TGFβ pathway, mRNA, and protein levels of TGFβ1 (panels C and D , respectively) and mRNA levels of SMAD3 (panel C ) were measured. Comparisons were done in three lentiviral transduced clones against three scramble controls ( N = 6). * Indicates statistical significance ( P < 0.05).
Article Snippet: Using a
Techniques: Expressing, Transduction, Sequencing, Marker, Activation Assay, Clone Assay
Journal: Investigative Ophthalmology & Visual Science
Article Title: Mechanical Strain of Corneal Epithelium Influences the Expression of Genes Implicated in Keratoconus
doi: 10.1167/iovs.66.1.52
Figure Lengend Snippet: WNT10A overexpression results in increase in TGFB1 mRNA expression. ( A ) Schematic of co-culture experiment, with WNT10A-overexpressing hTCepi cells in the upper chamber and primary activated fibroblasts in the lower chamber. WB demonstrates WNT10A overexpression (O/E) in epithelial cells transduced with a lentivirus coding for a WNT10A overexpression plasmid. The qPCR shows increased TGFB1 transcript levels in fibroblasts grown in co-culture with WNT10A overexpressing corneal epithelial cells. ( B ) Increased TGFB1 mRNA expression in two primary fibroblast cell lines sourced from different biological donors treated with 1 ng/mL of recombinant WNT10A. * Indicates statistical significance ( P < 0.05).
Article Snippet: Using a
Techniques: Over Expression, Expressing, Co-Culture Assay, Transduction, Plasmid Preparation, Recombinant
Journal: bioRxiv
Article Title: Ras-dependent activation of BMAL2 regulates hypoxic metabolism in pancreatic cancer
doi: 10.1101/2023.03.19.533333
Figure Lengend Snippet: ( A ) Oxygen tension (y-axis) as determined by an OxyLite probe in tumors from KPC mice breathing ambient air or pure oxygen (x-axis). Dark blue circles represent averages per tumor and boxplots illustrate their distribution. Light blue circles represent repeat measurments per tumor. ( B ) HIF target genes (orange) controlled directly or indirectly by BMAL2 (yellow). Indirect control involves both BMAL2’s negative influence on first (dark blue) or second tier (light blue) RP repressing HIF target genes, and positive influence on first (dark red) and second (light red) tier RP activating HIF target genes. ( C ) Fold change in cell growth relative to cells expressing non-targeting sgRNA in normoxic (21% O2) and hypoxic (1% O2) conditions ( D ) Number of migrated cells for cells expressing non-targeting or BMAL2-directed sgRNA in the indicated oxygen environment. P-values are derived from testing the indicated coefficients from a linear regression model. Significant interaction term suggests synergistic effects of BMAL2 pertubation and hypoxia on cell migration. ( E ) Media pH levels after 72 hours incubation. P-values derived from Welch’s t-test ( F ) Fold change in lactate levels in the indicated oxygen environment expressing either non-targeting or BMAL2-directed sgRNA ( G ) Western Blot for HIF1a, HIF2a,
Article Snippet: The
Techniques: Control, Expressing, Derivative Assay, Migration, Incubation, Western Blot
Journal: EBioMedicine
Article Title: Tumor cells induce LAMP2a expression in tumor-associated macrophage for cancer progression
doi: 10.1016/j.ebiom.2019.01.045
Figure Lengend Snippet: LAMP2a targets PRDX1 and CRTC1 to modulate macrophages activation. (a) LAMP2a expression in TS-stimulated BMDMs which were treated by bafilomycin (Bafilo) or not. (b) Protein level of GPADH binding to LAMP2a in TS-stimulated BMDMs treated by bafilomycin (Bafilo) or not. (c) LAMP2a, PRDX1, CRTC1 and IRG1 expression in co-IP experiments of TS-stimulated BMDMs treated by bafilomycin (Bafilo) or not. All the IP-proteins were immunoprecipitated by anti-LAMP2a antibody and detected by respective antibodies. (d) Protein level of PRDX1, CRTC1 and IRG1 in TS-stimulated BMDMs which were transfected by sh-NC, sh-L2a or not. (e) The surface plasmon resonances (SPR) of LAMP2a-bound PRDX1, CRTC1 and IRG proteins. The results were fitted as dissociation constants (KDs). (f) Protein level of LAMP2a, PRDX1 and CRTC1 in TS-stimulated, genetically modified mouse HSCs-derived macrophages. “SCR” represents sg-SRC vector and “V” represents overexpression control vector. (g) Heatmap of relative mRNA expression of macrophage activation-related genes in mouse HSCs-derived macrophages described as ( f ). “pMIG” stands for overexpression control vector. Data were measured by qPCR, normalized to corresponding groups as noted, represented as log2 scale, with β-actin as control. (h) LDH release of 4 T1, CT26, LL/2 cells after 24 h co-culture with genetically modified HSCs-derived macrophages at a ratio of 40:1 as E:T. The percentage of cytotoxicity was calculated by maximum tumor cells LDH release control. (i) CREB and CEBP/β expression in TS-stimulated BMDMs treated by sh-NC, sh-L2a or not. Total CREB protein was shown as pan-CREB, and S133-phosphorylated CREB was shown as p-CREB. (j) Luminescence assays of H 2 O 2 production in BMDMs which were transfected by shRNA after TS or normal medium culture. (k) Illustration of mechanism for LAMP2a-PRDX1/CRTC1 axis.
Article Snippet: The oligo sequences for guide RNA targeting Lamp2a , Prdx1 and
Techniques: Activation Assay, Expressing, Binding Assay, Co-Immunoprecipitation Assay, Immunoprecipitation, Transfection, Genetically Modified, Derivative Assay, Plasmid Preparation, Over Expression, Control, Co-Culture Assay, shRNA
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: Lysine acetyltransferase 6A (KAT6A) is upregulated in macrophages during sepsis. ( A ) Microarray-based transcriptomic analysis of peripheral blood samples from healthy individuals and sepsis patients in the GSE54514 dataset. Upregulated genes (red), downregulated genes (blue), and stable genes (grey) are indicated. ( B ) Expression levels of KAT6A in healthy individuals (n = 18) and sepsis patients (n = 26). ( C – H ) Single-cell RNA sequencing analysis of lung tissues from sham and CLP mice ( GSE207651 ). ( C ) Uniform Manifold Approximation and Projection (UMAP) visualization of cells from sham and CLP groups. ( D ) Bar chart depicting the relative abundances of different cell populations. ( E ) Bar chart of the relative abundances of cells in the mononuclear phagocyte (MPS) clusters. ( F ) Violin plot illustrates the distribution of KAT6A expression in macrophages from sham and CLP mice. ( G ) UMAP visualization of M1 and M2 macrophage subpopulations identified within the macrophage cluster. ( H ) Violin plots of KAT6A expression in M1 and M2 macrophage subsets. ( I ) Representative confocal microscopy images of KAT6A (red) and DAPI (blue) in peritoneal macrophages (PMs). scale bar: 20 µm (top); scale bar, 2 µm (bottom). ( J ) KAT6A expression in lung tissues from septic and sham-operated mice was analyzed by Western blot. The experiment was repeated three times independently with similar results. ( K ) Quantitative real-time PCR (qPCR) analysis of KAT6A mRNA levels in lung tissues from sepsis mice (n = 5) and sham-operated mice (n = 3). All data are mean ± SEM. * p < 0.05, *** p < 0.001, **** p < 0.0001 by two-tailed unpaired Student’s t test in panel ( K ). ns, not significant. Original Western blot images can be found in .
Article Snippet:
Techniques: Microarray, Expressing, Single Cell, RNA Sequencing, Confocal Microscopy, Western Blot, Real-time Polymerase Chain Reaction, Two Tailed Test
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: KAT6A inhibition suppresses glycolysis and reprograms macrophage metabolic activity. ( A – F ) PMs from C57BL/6J mice were pretreated with WM1119 or DMSO for 1 h, followed by stimulation with lipopolysaccharide (LPS, 100 ng/mL) for 6 h. Bulk RNA sequencing was performed on PMs to identify differentially expressed genes (DEGs) and enriched gene sets (n = 5). ( A ) Principal component analysis (PCA) of samples in different groups. ( B ) Volcano plot for DEGs. ( C ) Gene Set Enrichment Analysis (GSEA) plot showing enrichment score and normalized enrichment scores (NES) for glycolysis. ( D ) Heatmap shows expression of glycolytic genes. ( E ) Gene expression of glucose transporter 1 ( Glut1 ), hexokinase ( Hk ) 2 , Aldoc , Tpi1 , Aldh9a1 , Gapdh , Pgk1 , Pkm , Pgam1 , Eno1 and Ldha was measured by qPCR in PMs. Data are presented as fold change relative to the DMSO group (n = 3). ( F ) Lactate concentration in culture supernatants (n = 3). ( G ) Gene expression of Hif1α and c-Myc was measured by qPCR (n = 3). ( H – J ) Bone marrow-derived macrophages (BMDMs) from C57BL/6J mice were pretreated with WM1119 (100 μM) or DMSO for 1 h, followed by stimulation with LPS (100 ng/mL) for 24 h. ( H ) HIF1α and c-Myc expression were measured by Western blot, quantification of protein expression levels normalized to β-actin (n = 3). ( I , J ) GLUT1 and pyruvate kinase M2 (PKM2) expression was measured by Western blot, quantification of protein expression levels normalized to β-actin (n = 3). ( K – P ) BMDMs from C57BL/6J mice were pretreated with WM1119 (100 μM) or DMSO for 1 h, followed by stimulation with LPS (100 ng/mL) for 6 h. ( K ) BMDMs were incubated with 2-NBDG, a fluorescent glucose analogue, and glucose uptake was measured by flow cytometry. Mean fluorescence intensity (MFI) is shown (n = 6). ( L – P ) Extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were assessed with a Seahorse XF96 analyzer. ( L , M ) ECAR was measured following sequential injections of glucose, oligomycin (Oligo), and 2-deoxyglucose (2-DG), and the derived parameters for glycolysis and glycolytic capacity were quantified (n = 10). ( N , O ) OCR was determined after consecutive addition of Oligo, carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP), and rotenone/antimycin A (R/A), with analyses summarizing basal respiration, ATP-linked respiration, maximal respiration, and spare respiratory capacity (n = 6). ( P ) Ratio of OCR to ECAR. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Statistics were done by one-way ANOVA followed by adjustments for multiple comparisons in panels ( E , G , K ), and two-tailed unpaired Student’s t test in panels ( F , M , O , P ). ns, not significant. Original Western blot images can be found in .
Article Snippet:
Techniques: Inhibition, Activity Assay, RNA Sequencing, Expressing, Gene Expression, Concentration Assay, Derivative Assay, Western Blot, Incubation, Flow Cytometry, Fluorescence, Two Tailed Test
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: KAT6A inhibition attenuates inflammatory response in macrophages. ( A – D ) PMs and ( E , F ) BMDMs from C57BL/6J mice were pretreated with WM1119 at the indicated concentrations or DMSO for 1 h, followed by stimulation with LPS (100 ng/mL) for 6 h. ( A ) Experimental scheme in PMs. ( B ) qPCR analysis of Tnfα , Il-1β , Il-6 , Nos2 , Il-10 (n = 3). ( C , D ) Flow cytometric analysis of TNFα and IL-6 production in F4/80 + CD11b + cells (n = 3). ( E ) Experimental scheme in BMDMs. ( F ) qPCR analysis of Tnfα , Il-1β , Il-6 , Nos2 , Il-10 (n = 3). Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Statistics were done by one-way ANOVA followed by adjustments for multiple comparisons in panels ( B – D , F ). ns, not significant.
Article Snippet:
Techniques: Inhibition
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: KAT6A inhibition suppresses M1 macrophage polarization. BMDMs were pretreated with WM1119 at the indicated concentrations or DMSO for 1 h, followed by stimulation with LPS (100 ng/mL) and interferon-gamma (IFN-γ) (50 ng/mL) for 48 h. ( A ) Experimental scheme. ( B ) Representative flow cytometric analysis of surface markers CD86 expression on F4/80 + BMDMs (n = 5). ( C , D ) qPCR analysis of Cd86 , Tnfα , Il-1β , Il-6 , Nos2 , Il-10 expression (n = 3). RAW264.7 macrophages transfected with siKAT6A or scramble control were stimulated with LPS and IFN-γ for 48 h. ( E ) Knockdown of KAT6A was confirmed by Western blot (n = 3). ( F ) Representative flow cytometric analysis and quantification of 2-NBDG uptake (n = 3). ( G , H ) qPCR analysis of glycolytic genes Glut1 , Hk2 , Pkm , Eno1 and Ldha (n = 3). ( I ) Lactate concentration in culture supernatants (n = 3). ( J ) Immunoblot analysis of H3K9ac and H3K27ac acetylation. Representative bands of six biologically independent replicates. ( K ) Representative flow cytometric analysis and quantification of CD86 expression in RAW264.7 macrophages (n = 3). ( L ) Representative flow cytometric analysis and quantification of intracellular TNFα and NOS2 expression (n = 3). All data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Statistics were done by one-way ANOVA followed by adjustments for multiple comparisons in panels ( B – D ) and two-tailed unpaired Student’s t test in panels ( F – I , K , L ). ns, not significant. Original Western blot images can be found in .
Article Snippet:
Techniques: Inhibition, Expressing, Transfection, Control, Knockdown, Western Blot, Concentration Assay, Two Tailed Test
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: KAT6A inhibition is associated with reduced PI3K-AKT-mTOR signaling and M1 macrophage polarization. ( A ) KEGG enrichment of environmental information processing in down-regulated DEGs derived from WM1119-treated PMs. DEGs were defined as described in . ( B ) GSEA plot showing enrichment score and NES for mTOR complex 1 (mTORC1) signaling. ( C ) KEGG enrichment of metabolism in down-regulated genes. ( D – I ) BMDMs from C57BL/6J mice were pretreated with WM1119 (100 μM) or DMSO for 1 h, followed by stimulation with LPS (100 ng/mL) for 24 h. Western blot images of the protein expression of ( D ) p-PI3K p85 , PI3K, p-AKT S473 and AKT and ( E ) p-mTOR S2448 , mTOR, and Raptor in the indicated groups. Quantification of protein expression levels normalized to β-actin (n = 3). BMDMs were stained for p-AKT S473 ( F , G ) and p-S6 S235/236 ( H , I ) and analyzed by flow cytometry. (n = 6). All data are mean ± SEM. **** p < 0.0001. Statistics were done by a two-tailed unpaired Student’s t test in panels ( G , I ). Original Western blot images can be found in .
Article Snippet:
Techniques: Inhibition, Derivative Assay, Western Blot, Expressing, Staining, Flow Cytometry, Two Tailed Test
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: KAT6A inhibition protects against organ injury at 12 h after CLP-induced sepsis. ( A ) Scheme of the mouse experiment. C57BL/6J mice were randomly assigned to three groups. 4 h after receiving vehicle or WM1119 (50 mg/kg), mice were subjected to sham or CLP surgery. All mice were euthanized 12 h after surgery for organ injury assessment. ( B ) H&E staining and histological score of lung, liver and colon sections from the indicated groups. Scale bar: 100 µm (lung, liver), Scale bar: 50 µm (colon) (n = 3 for sham group, n = 5 for CLP group, n = 4 for CLP+WM1119 group). ( C ) qPCR of cytokine genes ( Tnfα , Il-1β , Il-6 , Nos2 , Il-10 ) in lung tissues from the indicated groups (n = 3 for sham group, n = 5 for CLP and CLP+WM1119 group). All data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Statistics were done by one-way ANOVA followed by adjustments for multiple comparisons in panels ( B , C ).
Article Snippet:
Techniques: Inhibition, Staining
Journal: Biomolecules
Article Title: Lysine Acetyltransferase 6A Drives M1 Macrophage Polarization Through Metabolic Reprogramming in Sepsis-Induced Acute Lung Injury
doi: 10.3390/biom16040609
Figure Lengend Snippet: KAT6A inhibition protects against organ injury and promotes bacterial clearance at 24 h after CLP-induced sepsis. ( A ) Scheme of the mouse experiment. Mice were pretreated with WM1119 (50 mg/kg) or vehicle 4 h before CLP. Mice were euthanized 24 h after CLP, and tissues were harvested for analysis. ( B ) 24 h survival rate was recorded. ( C – E ) Representative H&E staining images of lung, liver and colon from septic mice treated with WM1119 or vehicle, with their respective histological scores quantified in ( F ) (n = 6). Scale bar: 100 μm ( C , D ), Scale bar: 50 μm ( E ). ( G , H ) Serum concentrations of aspartate aminotransferase (AST), alanine aminotransferase (ALT), creatine kinase (CK), urea, and creatinine (Crea) were measured in the indicated groups (n = 6). Bacterial burden was quantified as colony-forming units (CFU) per mL for peritoneal fluid ( I ) (n = 6) and CFU per gram for lung tissues ( J ) (n = 6). ( K ) Correlations between KAT6A mRNA expression levels and lung CFUs (n = 6 for each group). ( L ) The percentage of M1 macrophages (F4/80 + CD86 + ) in septic lung tissues treated with WM1119 or vehicle (n = 6). ( M ) qPCR of cytokine genes ( Tnfα , Il-6 , Nos2 , Il-1β ) in lung tissues treated with WM1119 or vehicle (n = 6). All data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Statistics were done by a two-tailed unpaired Student’s t test in panels ( B , F , G – J , L , M ). Correlation was assessed by the Pearson correlation coefficient in panel ( K ).
Article Snippet:
Techniques: Inhibition, Staining, Expressing, Two Tailed Test